ID: 1175606636

View in Genome Browser
Species Human (GRCh38)
Location 20:60316808-60316830
Sequence ACTTGGGGAACACAAGGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175606636_1175606645 30 Left 1175606636 20:60316808-60316830 CCTTATCCTTGTGTTCCCCAAGT No data
Right 1175606645 20:60316861-60316883 TGTCTCTGTGTTCCGCCTCTGGG No data
1175606636_1175606640 -7 Left 1175606636 20:60316808-60316830 CCTTATCCTTGTGTTCCCCAAGT No data
Right 1175606640 20:60316824-60316846 CCCAAGTCTCCTATCAAAGCTGG No data
1175606636_1175606643 7 Left 1175606636 20:60316808-60316830 CCTTATCCTTGTGTTCCCCAAGT No data
Right 1175606643 20:60316838-60316860 CAAAGCTGGTTCTTGCTGAATGG No data
1175606636_1175606644 29 Left 1175606636 20:60316808-60316830 CCTTATCCTTGTGTTCCCCAAGT No data
Right 1175606644 20:60316860-60316882 GTGTCTCTGTGTTCCGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175606636 Original CRISPR ACTTGGGGAACACAAGGATA AGG (reversed) Intergenic
No off target data available for this crispr