ID: 1175606637

View in Genome Browser
Species Human (GRCh38)
Location 20:60316814-60316836
Sequence TAGGAGACTTGGGGAACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175606637_1175606645 24 Left 1175606637 20:60316814-60316836 CCTTGTGTTCCCCAAGTCTCCTA No data
Right 1175606645 20:60316861-60316883 TGTCTCTGTGTTCCGCCTCTGGG No data
1175606637_1175606643 1 Left 1175606637 20:60316814-60316836 CCTTGTGTTCCCCAAGTCTCCTA No data
Right 1175606643 20:60316838-60316860 CAAAGCTGGTTCTTGCTGAATGG No data
1175606637_1175606646 25 Left 1175606637 20:60316814-60316836 CCTTGTGTTCCCCAAGTCTCCTA No data
Right 1175606646 20:60316862-60316884 GTCTCTGTGTTCCGCCTCTGGGG No data
1175606637_1175606644 23 Left 1175606637 20:60316814-60316836 CCTTGTGTTCCCCAAGTCTCCTA No data
Right 1175606644 20:60316860-60316882 GTGTCTCTGTGTTCCGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175606637 Original CRISPR TAGGAGACTTGGGGAACACA AGG (reversed) Intergenic