ID: 1175606639

View in Genome Browser
Species Human (GRCh38)
Location 20:60316824-60316846
Sequence CCAGCTTTGATAGGAGACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175606639_1175606647 21 Left 1175606639 20:60316824-60316846 CCCAAGTCTCCTATCAAAGCTGG No data
Right 1175606647 20:60316868-60316890 GTGTTCCGCCTCTGGGGCGTTGG No data
1175606639_1175606650 29 Left 1175606639 20:60316824-60316846 CCCAAGTCTCCTATCAAAGCTGG No data
Right 1175606650 20:60316876-60316898 CCTCTGGGGCGTTGGTCATGAGG No data
1175606639_1175606646 15 Left 1175606639 20:60316824-60316846 CCCAAGTCTCCTATCAAAGCTGG No data
Right 1175606646 20:60316862-60316884 GTCTCTGTGTTCCGCCTCTGGGG No data
1175606639_1175606643 -9 Left 1175606639 20:60316824-60316846 CCCAAGTCTCCTATCAAAGCTGG No data
Right 1175606643 20:60316838-60316860 CAAAGCTGGTTCTTGCTGAATGG No data
1175606639_1175606645 14 Left 1175606639 20:60316824-60316846 CCCAAGTCTCCTATCAAAGCTGG No data
Right 1175606645 20:60316861-60316883 TGTCTCTGTGTTCCGCCTCTGGG No data
1175606639_1175606644 13 Left 1175606639 20:60316824-60316846 CCCAAGTCTCCTATCAAAGCTGG No data
Right 1175606644 20:60316860-60316882 GTGTCTCTGTGTTCCGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175606639 Original CRISPR CCAGCTTTGATAGGAGACTT GGG (reversed) Intergenic
No off target data available for this crispr