ID: 1175606643

View in Genome Browser
Species Human (GRCh38)
Location 20:60316838-60316860
Sequence CAAAGCTGGTTCTTGCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175606639_1175606643 -9 Left 1175606639 20:60316824-60316846 CCCAAGTCTCCTATCAAAGCTGG No data
Right 1175606643 20:60316838-60316860 CAAAGCTGGTTCTTGCTGAATGG No data
1175606635_1175606643 16 Left 1175606635 20:60316799-60316821 CCTCAAATGCCTTATCCTTGTGT No data
Right 1175606643 20:60316838-60316860 CAAAGCTGGTTCTTGCTGAATGG No data
1175606636_1175606643 7 Left 1175606636 20:60316808-60316830 CCTTATCCTTGTGTTCCCCAAGT No data
Right 1175606643 20:60316838-60316860 CAAAGCTGGTTCTTGCTGAATGG No data
1175606637_1175606643 1 Left 1175606637 20:60316814-60316836 CCTTGTGTTCCCCAAGTCTCCTA No data
Right 1175606643 20:60316838-60316860 CAAAGCTGGTTCTTGCTGAATGG No data
1175606638_1175606643 -8 Left 1175606638 20:60316823-60316845 CCCCAAGTCTCCTATCAAAGCTG No data
Right 1175606643 20:60316838-60316860 CAAAGCTGGTTCTTGCTGAATGG No data
1175606641_1175606643 -10 Left 1175606641 20:60316825-60316847 CCAAGTCTCCTATCAAAGCTGGT No data
Right 1175606643 20:60316838-60316860 CAAAGCTGGTTCTTGCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175606643 Original CRISPR CAAAGCTGGTTCTTGCTGAA TGG Intergenic
No off target data available for this crispr