ID: 1175606647

View in Genome Browser
Species Human (GRCh38)
Location 20:60316868-60316890
Sequence GTGTTCCGCCTCTGGGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175606641_1175606647 20 Left 1175606641 20:60316825-60316847 CCAAGTCTCCTATCAAAGCTGGT No data
Right 1175606647 20:60316868-60316890 GTGTTCCGCCTCTGGGGCGTTGG No data
1175606642_1175606647 12 Left 1175606642 20:60316833-60316855 CCTATCAAAGCTGGTTCTTGCTG No data
Right 1175606647 20:60316868-60316890 GTGTTCCGCCTCTGGGGCGTTGG No data
1175606638_1175606647 22 Left 1175606638 20:60316823-60316845 CCCCAAGTCTCCTATCAAAGCTG No data
Right 1175606647 20:60316868-60316890 GTGTTCCGCCTCTGGGGCGTTGG No data
1175606639_1175606647 21 Left 1175606639 20:60316824-60316846 CCCAAGTCTCCTATCAAAGCTGG No data
Right 1175606647 20:60316868-60316890 GTGTTCCGCCTCTGGGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175606647 Original CRISPR GTGTTCCGCCTCTGGGGCGT TGG Intergenic
No off target data available for this crispr