ID: 1175608208

View in Genome Browser
Species Human (GRCh38)
Location 20:60328687-60328709
Sequence CTGTGAATTAGGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175608208_1175608217 20 Left 1175608208 20:60328687-60328709 CCCTCCACCTCCCTAATTCACAG No data
Right 1175608217 20:60328730-60328752 CTCCTAATGAAGGAGTGGCATGG No data
1175608208_1175608215 10 Left 1175608208 20:60328687-60328709 CCCTCCACCTCCCTAATTCACAG No data
Right 1175608215 20:60328720-60328742 TAGATTTCATCTCCTAATGAAGG No data
1175608208_1175608216 15 Left 1175608208 20:60328687-60328709 CCCTCCACCTCCCTAATTCACAG No data
Right 1175608216 20:60328725-60328747 TTCATCTCCTAATGAAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175608208 Original CRISPR CTGTGAATTAGGGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr