ID: 1175613681

View in Genome Browser
Species Human (GRCh38)
Location 20:60373946-60373968
Sequence TTCCCATGAAAACACAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175613681_1175613686 7 Left 1175613681 20:60373946-60373968 CCTTCACTGTGTTTTCATGGGAA No data
Right 1175613686 20:60373976-60373998 GAGAAACAAAGTGAGCAAGTGGG No data
1175613681_1175613687 8 Left 1175613681 20:60373946-60373968 CCTTCACTGTGTTTTCATGGGAA No data
Right 1175613687 20:60373977-60373999 AGAAACAAAGTGAGCAAGTGGGG No data
1175613681_1175613685 6 Left 1175613681 20:60373946-60373968 CCTTCACTGTGTTTTCATGGGAA No data
Right 1175613685 20:60373975-60373997 GGAGAAACAAAGTGAGCAAGTGG No data
1175613681_1175613688 12 Left 1175613681 20:60373946-60373968 CCTTCACTGTGTTTTCATGGGAA No data
Right 1175613688 20:60373981-60374003 ACAAAGTGAGCAAGTGGGGCAGG No data
1175613681_1175613689 23 Left 1175613681 20:60373946-60373968 CCTTCACTGTGTTTTCATGGGAA No data
Right 1175613689 20:60373992-60374014 AAGTGGGGCAGGCTTTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175613681 Original CRISPR TTCCCATGAAAACACAGTGA AGG (reversed) Intergenic
No off target data available for this crispr