ID: 1175613985

View in Genome Browser
Species Human (GRCh38)
Location 20:60376965-60376987
Sequence GTTTATCAGCAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175613981_1175613985 -3 Left 1175613981 20:60376945-60376967 CCAGGCCAGAAGTAGTAGTAGTT No data
Right 1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG No data
1175613982_1175613985 -8 Left 1175613982 20:60376950-60376972 CCAGAAGTAGTAGTAGTTTATCA No data
Right 1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175613985 Original CRISPR GTTTATCAGCAGAGGGAAGA AGG Intergenic
No off target data available for this crispr