ID: 1175616512

View in Genome Browser
Species Human (GRCh38)
Location 20:60404604-60404626
Sequence TCTCCAGTAGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 645376
Summary {0: 295, 1: 9238, 2: 119517, 3: 266931, 4: 249395}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175616512_1175616522 15 Left 1175616512 20:60404604-60404626 CCTGTAATCCCAGCTACTGGAGA 0: 295
1: 9238
2: 119517
3: 266931
4: 249395
Right 1175616522 20:60404642-60404664 TAAGTTGAACCTGGGAAGCGGGG No data
1175616512_1175616519 7 Left 1175616512 20:60404604-60404626 CCTGTAATCCCAGCTACTGGAGA 0: 295
1: 9238
2: 119517
3: 266931
4: 249395
Right 1175616519 20:60404634-60404656 GCAGGGAATAAGTTGAACCTGGG No data
1175616512_1175616523 16 Left 1175616512 20:60404604-60404626 CCTGTAATCCCAGCTACTGGAGA 0: 295
1: 9238
2: 119517
3: 266931
4: 249395
Right 1175616523 20:60404643-60404665 AAGTTGAACCTGGGAAGCGGGGG No data
1175616512_1175616518 6 Left 1175616512 20:60404604-60404626 CCTGTAATCCCAGCTACTGGAGA 0: 295
1: 9238
2: 119517
3: 266931
4: 249395
Right 1175616518 20:60404633-60404655 GGCAGGGAATAAGTTGAACCTGG No data
1175616512_1175616517 -10 Left 1175616512 20:60404604-60404626 CCTGTAATCCCAGCTACTGGAGA 0: 295
1: 9238
2: 119517
3: 266931
4: 249395
Right 1175616517 20:60404617-60404639 CTACTGGAGAAGCTGAGGCAGGG No data
1175616512_1175616521 14 Left 1175616512 20:60404604-60404626 CCTGTAATCCCAGCTACTGGAGA 0: 295
1: 9238
2: 119517
3: 266931
4: 249395
Right 1175616521 20:60404641-60404663 ATAAGTTGAACCTGGGAAGCGGG No data
1175616512_1175616520 13 Left 1175616512 20:60404604-60404626 CCTGTAATCCCAGCTACTGGAGA 0: 295
1: 9238
2: 119517
3: 266931
4: 249395
Right 1175616520 20:60404640-60404662 AATAAGTTGAACCTGGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175616512 Original CRISPR TCTCCAGTAGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr