ID: 1175616513

View in Genome Browser
Species Human (GRCh38)
Location 20:60404612-60404634
Sequence CCTCAGCTTCTCCAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 555720
Summary {0: 35, 1: 1500, 2: 27619, 3: 243335, 4: 283231}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175616513_1175616522 7 Left 1175616513 20:60404612-60404634 CCCAGCTACTGGAGAAGCTGAGG 0: 35
1: 1500
2: 27619
3: 243335
4: 283231
Right 1175616522 20:60404642-60404664 TAAGTTGAACCTGGGAAGCGGGG No data
1175616513_1175616520 5 Left 1175616513 20:60404612-60404634 CCCAGCTACTGGAGAAGCTGAGG 0: 35
1: 1500
2: 27619
3: 243335
4: 283231
Right 1175616520 20:60404640-60404662 AATAAGTTGAACCTGGGAAGCGG No data
1175616513_1175616523 8 Left 1175616513 20:60404612-60404634 CCCAGCTACTGGAGAAGCTGAGG 0: 35
1: 1500
2: 27619
3: 243335
4: 283231
Right 1175616523 20:60404643-60404665 AAGTTGAACCTGGGAAGCGGGGG No data
1175616513_1175616521 6 Left 1175616513 20:60404612-60404634 CCCAGCTACTGGAGAAGCTGAGG 0: 35
1: 1500
2: 27619
3: 243335
4: 283231
Right 1175616521 20:60404641-60404663 ATAAGTTGAACCTGGGAAGCGGG No data
1175616513_1175616518 -2 Left 1175616513 20:60404612-60404634 CCCAGCTACTGGAGAAGCTGAGG 0: 35
1: 1500
2: 27619
3: 243335
4: 283231
Right 1175616518 20:60404633-60404655 GGCAGGGAATAAGTTGAACCTGG No data
1175616513_1175616519 -1 Left 1175616513 20:60404612-60404634 CCCAGCTACTGGAGAAGCTGAGG 0: 35
1: 1500
2: 27619
3: 243335
4: 283231
Right 1175616519 20:60404634-60404656 GCAGGGAATAAGTTGAACCTGGG No data
1175616513_1175616525 24 Left 1175616513 20:60404612-60404634 CCCAGCTACTGGAGAAGCTGAGG 0: 35
1: 1500
2: 27619
3: 243335
4: 283231
Right 1175616525 20:60404659-60404681 GCGGGGGTTGCAGTGAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175616513 Original CRISPR CCTCAGCTTCTCCAGTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr