ID: 1175616515

View in Genome Browser
Species Human (GRCh38)
Location 20:60404613-60404635
Sequence GCCTCAGCTTCTCCAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 512880
Summary {0: 26, 1: 1191, 2: 23216, 3: 220752, 4: 267695}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175616515_1175616523 7 Left 1175616515 20:60404613-60404635 CCAGCTACTGGAGAAGCTGAGGC 0: 26
1: 1191
2: 23216
3: 220752
4: 267695
Right 1175616523 20:60404643-60404665 AAGTTGAACCTGGGAAGCGGGGG No data
1175616515_1175616518 -3 Left 1175616515 20:60404613-60404635 CCAGCTACTGGAGAAGCTGAGGC 0: 26
1: 1191
2: 23216
3: 220752
4: 267695
Right 1175616518 20:60404633-60404655 GGCAGGGAATAAGTTGAACCTGG No data
1175616515_1175616525 23 Left 1175616515 20:60404613-60404635 CCAGCTACTGGAGAAGCTGAGGC 0: 26
1: 1191
2: 23216
3: 220752
4: 267695
Right 1175616525 20:60404659-60404681 GCGGGGGTTGCAGTGAGCTGAGG No data
1175616515_1175616520 4 Left 1175616515 20:60404613-60404635 CCAGCTACTGGAGAAGCTGAGGC 0: 26
1: 1191
2: 23216
3: 220752
4: 267695
Right 1175616520 20:60404640-60404662 AATAAGTTGAACCTGGGAAGCGG No data
1175616515_1175616519 -2 Left 1175616515 20:60404613-60404635 CCAGCTACTGGAGAAGCTGAGGC 0: 26
1: 1191
2: 23216
3: 220752
4: 267695
Right 1175616519 20:60404634-60404656 GCAGGGAATAAGTTGAACCTGGG No data
1175616515_1175616521 5 Left 1175616515 20:60404613-60404635 CCAGCTACTGGAGAAGCTGAGGC 0: 26
1: 1191
2: 23216
3: 220752
4: 267695
Right 1175616521 20:60404641-60404663 ATAAGTTGAACCTGGGAAGCGGG No data
1175616515_1175616522 6 Left 1175616515 20:60404613-60404635 CCAGCTACTGGAGAAGCTGAGGC 0: 26
1: 1191
2: 23216
3: 220752
4: 267695
Right 1175616522 20:60404642-60404664 TAAGTTGAACCTGGGAAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175616515 Original CRISPR GCCTCAGCTTCTCCAGTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr