ID: 1175616521

View in Genome Browser
Species Human (GRCh38)
Location 20:60404641-60404663
Sequence ATAAGTTGAACCTGGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175616515_1175616521 5 Left 1175616515 20:60404613-60404635 CCAGCTACTGGAGAAGCTGAGGC 0: 26
1: 1191
2: 23216
3: 220752
4: 267695
Right 1175616521 20:60404641-60404663 ATAAGTTGAACCTGGGAAGCGGG No data
1175616512_1175616521 14 Left 1175616512 20:60404604-60404626 CCTGTAATCCCAGCTACTGGAGA 0: 295
1: 9238
2: 119517
3: 266931
4: 249395
Right 1175616521 20:60404641-60404663 ATAAGTTGAACCTGGGAAGCGGG No data
1175616513_1175616521 6 Left 1175616513 20:60404612-60404634 CCCAGCTACTGGAGAAGCTGAGG 0: 35
1: 1500
2: 27619
3: 243335
4: 283231
Right 1175616521 20:60404641-60404663 ATAAGTTGAACCTGGGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175616521 Original CRISPR ATAAGTTGAACCTGGGAAGC GGG Intergenic
No off target data available for this crispr