ID: 1175616877

View in Genome Browser
Species Human (GRCh38)
Location 20:60407238-60407260
Sequence GGGCCTGCTCACACCCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175616869_1175616877 -2 Left 1175616869 20:60407217-60407239 CCACACTCCCCATGCAATCCTGG No data
Right 1175616877 20:60407238-60407260 GGGCCTGCTCACACCCATGAGGG No data
1175616872_1175616877 -9 Left 1175616872 20:60407224-60407246 CCCCATGCAATCCTGGGCCTGCT No data
Right 1175616877 20:60407238-60407260 GGGCCTGCTCACACCCATGAGGG No data
1175616873_1175616877 -10 Left 1175616873 20:60407225-60407247 CCCATGCAATCCTGGGCCTGCTC No data
Right 1175616877 20:60407238-60407260 GGGCCTGCTCACACCCATGAGGG No data
1175616868_1175616877 5 Left 1175616868 20:60407210-60407232 CCAGTCTCCACACTCCCCATGCA No data
Right 1175616877 20:60407238-60407260 GGGCCTGCTCACACCCATGAGGG No data
1175616865_1175616877 14 Left 1175616865 20:60407201-60407223 CCCCTCTCACCAGTCTCCACACT No data
Right 1175616877 20:60407238-60407260 GGGCCTGCTCACACCCATGAGGG No data
1175616867_1175616877 12 Left 1175616867 20:60407203-60407225 CCTCTCACCAGTCTCCACACTCC No data
Right 1175616877 20:60407238-60407260 GGGCCTGCTCACACCCATGAGGG No data
1175616866_1175616877 13 Left 1175616866 20:60407202-60407224 CCCTCTCACCAGTCTCCACACTC No data
Right 1175616877 20:60407238-60407260 GGGCCTGCTCACACCCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175616877 Original CRISPR GGGCCTGCTCACACCCATGA GGG Intergenic
No off target data available for this crispr