ID: 1175618710

View in Genome Browser
Species Human (GRCh38)
Location 20:60424875-60424897
Sequence TGGTGGCAGTGGCAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175618700_1175618710 7 Left 1175618700 20:60424845-60424867 CCAGTTTGAATTCTGTTGGGAAG No data
Right 1175618710 20:60424875-60424897 TGGTGGCAGTGGCAAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175618710 Original CRISPR TGGTGGCAGTGGCAAGGGGA GGG Intergenic
No off target data available for this crispr