ID: 1175621993

View in Genome Browser
Species Human (GRCh38)
Location 20:60455103-60455125
Sequence CAGTGAAACCAGAGGACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175621990_1175621993 -10 Left 1175621990 20:60455090-60455112 CCTGCTCCATTTTCAGTGAAACC No data
Right 1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG No data
1175621989_1175621993 17 Left 1175621989 20:60455063-60455085 CCTGTAAAAACTATGCTCTTTTT No data
Right 1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175621993 Original CRISPR CAGTGAAACCAGAGGACAGA TGG Intergenic
No off target data available for this crispr