ID: 1175625126

View in Genome Browser
Species Human (GRCh38)
Location 20:60483569-60483591
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625126_1175625135 15 Left 1175625126 20:60483569-60483591 CCTCTGCGTCTTAGTACCTGTCC No data
Right 1175625135 20:60483607-60483629 TGTGCTGAGCTAATGGAGCAAGG No data
1175625126_1175625136 29 Left 1175625126 20:60483569-60483591 CCTCTGCGTCTTAGTACCTGTCC No data
Right 1175625136 20:60483621-60483643 GGAGCAAGGCCACCATAGCTTGG No data
1175625126_1175625133 8 Left 1175625126 20:60483569-60483591 CCTCTGCGTCTTAGTACCTGTCC No data
Right 1175625133 20:60483600-60483622 GGTTTCCTGTGCTGAGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625126 Original CRISPR GGACAGGTACTAAGACGCAG AGG (reversed) Intergenic