ID: 1175625133

View in Genome Browser
Species Human (GRCh38)
Location 20:60483600-60483622
Sequence GGTTTCCTGTGCTGAGCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625130_1175625133 -8 Left 1175625130 20:60483585-60483607 CCTGTCCCAAAGGGAGGTTTCCT No data
Right 1175625133 20:60483600-60483622 GGTTTCCTGTGCTGAGCTAATGG No data
1175625126_1175625133 8 Left 1175625126 20:60483569-60483591 CCTCTGCGTCTTAGTACCTGTCC No data
Right 1175625133 20:60483600-60483622 GGTTTCCTGTGCTGAGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625133 Original CRISPR GGTTTCCTGTGCTGAGCTAA TGG Intergenic