ID: 1175625134

View in Genome Browser
Species Human (GRCh38)
Location 20:60483605-60483627
Sequence TTGCTCCATTAGCTCAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625134_1175625140 18 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625140 20:60483646-60483668 GACTGAATTAAAACCCCAAGTGG No data
1175625134_1175625136 -7 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625136 20:60483621-60483643 GGAGCAAGGCCACCATAGCTTGG No data
1175625134_1175625141 19 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625141 20:60483647-60483669 ACTGAATTAAAACCCCAAGTGGG No data
1175625134_1175625144 29 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625144 20:60483657-60483679 AACCCCAAGTGGGGTCTGCTGGG No data
1175625134_1175625143 28 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625143 20:60483656-60483678 AAACCCCAAGTGGGGTCTGCTGG No data
1175625134_1175625137 -4 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625137 20:60483624-60483646 GCAAGGCCACCATAGCTTGGAGG No data
1175625134_1175625142 20 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625142 20:60483648-60483670 CTGAATTAAAACCCCAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625134 Original CRISPR TTGCTCCATTAGCTCAGCAC AGG (reversed) Intergenic
No off target data available for this crispr