ID: 1175625136

View in Genome Browser
Species Human (GRCh38)
Location 20:60483621-60483643
Sequence GGAGCAAGGCCACCATAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625126_1175625136 29 Left 1175625126 20:60483569-60483591 CCTCTGCGTCTTAGTACCTGTCC No data
Right 1175625136 20:60483621-60483643 GGAGCAAGGCCACCATAGCTTGG No data
1175625132_1175625136 7 Left 1175625132 20:60483591-60483613 CCAAAGGGAGGTTTCCTGTGCTG No data
Right 1175625136 20:60483621-60483643 GGAGCAAGGCCACCATAGCTTGG No data
1175625134_1175625136 -7 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625136 20:60483621-60483643 GGAGCAAGGCCACCATAGCTTGG No data
1175625131_1175625136 8 Left 1175625131 20:60483590-60483612 CCCAAAGGGAGGTTTCCTGTGCT No data
Right 1175625136 20:60483621-60483643 GGAGCAAGGCCACCATAGCTTGG No data
1175625130_1175625136 13 Left 1175625130 20:60483585-60483607 CCTGTCCCAAAGGGAGGTTTCCT No data
Right 1175625136 20:60483621-60483643 GGAGCAAGGCCACCATAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625136 Original CRISPR GGAGCAAGGCCACCATAGCT TGG Intergenic