ID: 1175625137

View in Genome Browser
Species Human (GRCh38)
Location 20:60483624-60483646
Sequence GCAAGGCCACCATAGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625132_1175625137 10 Left 1175625132 20:60483591-60483613 CCAAAGGGAGGTTTCCTGTGCTG No data
Right 1175625137 20:60483624-60483646 GCAAGGCCACCATAGCTTGGAGG No data
1175625134_1175625137 -4 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625137 20:60483624-60483646 GCAAGGCCACCATAGCTTGGAGG No data
1175625130_1175625137 16 Left 1175625130 20:60483585-60483607 CCTGTCCCAAAGGGAGGTTTCCT No data
Right 1175625137 20:60483624-60483646 GCAAGGCCACCATAGCTTGGAGG No data
1175625131_1175625137 11 Left 1175625131 20:60483590-60483612 CCCAAAGGGAGGTTTCCTGTGCT No data
Right 1175625137 20:60483624-60483646 GCAAGGCCACCATAGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625137 Original CRISPR GCAAGGCCACCATAGCTTGG AGG Intergenic