ID: 1175625139

View in Genome Browser
Species Human (GRCh38)
Location 20:60483633-60483655
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625139_1175625148 7 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625148 20:60483663-60483685 AAGTGGGGTCTGCTGGGTGCTGG No data
1175625139_1175625153 25 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625153 20:60483681-60483703 GCTGGTCAAATGATGGGGAAGGG No data
1175625139_1175625140 -10 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625140 20:60483646-60483668 GACTGAATTAAAACCCCAAGTGG No data
1175625139_1175625142 -8 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625142 20:60483648-60483670 CTGAATTAAAACCCCAAGTGGGG No data
1175625139_1175625150 19 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625150 20:60483675-60483697 CTGGGTGCTGGTCAAATGATGGG No data
1175625139_1175625149 18 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625149 20:60483674-60483696 GCTGGGTGCTGGTCAAATGATGG No data
1175625139_1175625154 26 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625154 20:60483682-60483704 CTGGTCAAATGATGGGGAAGGGG No data
1175625139_1175625144 1 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625144 20:60483657-60483679 AACCCCAAGTGGGGTCTGCTGGG No data
1175625139_1175625151 20 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625151 20:60483676-60483698 TGGGTGCTGGTCAAATGATGGGG No data
1175625139_1175625152 24 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625152 20:60483680-60483702 TGCTGGTCAAATGATGGGGAAGG No data
1175625139_1175625141 -9 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625141 20:60483647-60483669 ACTGAATTAAAACCCCAAGTGGG No data
1175625139_1175625143 0 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625143 20:60483656-60483678 AAACCCCAAGTGGGGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625139 Original CRISPR TAATTCAGTCCTCCAAGCTA TGG (reversed) Intergenic
No off target data available for this crispr