ID: 1175625142

View in Genome Browser
Species Human (GRCh38)
Location 20:60483648-60483670
Sequence CTGAATTAAAACCCCAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625139_1175625142 -8 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625142 20:60483648-60483670 CTGAATTAAAACCCCAAGTGGGG No data
1175625138_1175625142 -5 Left 1175625138 20:60483630-60483652 CCACCATAGCTTGGAGGACTGAA No data
Right 1175625142 20:60483648-60483670 CTGAATTAAAACCCCAAGTGGGG No data
1175625134_1175625142 20 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625142 20:60483648-60483670 CTGAATTAAAACCCCAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625142 Original CRISPR CTGAATTAAAACCCCAAGTG GGG Intergenic
No off target data available for this crispr