ID: 1175625144

View in Genome Browser
Species Human (GRCh38)
Location 20:60483657-60483679
Sequence AACCCCAAGTGGGGTCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625134_1175625144 29 Left 1175625134 20:60483605-60483627 CCTGTGCTGAGCTAATGGAGCAA No data
Right 1175625144 20:60483657-60483679 AACCCCAAGTGGGGTCTGCTGGG No data
1175625138_1175625144 4 Left 1175625138 20:60483630-60483652 CCACCATAGCTTGGAGGACTGAA No data
Right 1175625144 20:60483657-60483679 AACCCCAAGTGGGGTCTGCTGGG No data
1175625139_1175625144 1 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625144 20:60483657-60483679 AACCCCAAGTGGGGTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625144 Original CRISPR AACCCCAAGTGGGGTCTGCT GGG Intergenic