ID: 1175625145

View in Genome Browser
Species Human (GRCh38)
Location 20:60483659-60483681
Sequence CACCCAGCAGACCCCACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625145_1175625152 -2 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625152 20:60483680-60483702 TGCTGGTCAAATGATGGGGAAGG No data
1175625145_1175625156 15 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625156 20:60483697-60483719 GGAAGGGGAGCTCTAGGTACAGG No data
1175625145_1175625155 9 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625155 20:60483691-60483713 TGATGGGGAAGGGGAGCTCTAGG No data
1175625145_1175625154 0 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625154 20:60483682-60483704 CTGGTCAAATGATGGGGAAGGGG No data
1175625145_1175625149 -8 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625149 20:60483674-60483696 GCTGGGTGCTGGTCAAATGATGG No data
1175625145_1175625153 -1 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625153 20:60483681-60483703 GCTGGTCAAATGATGGGGAAGGG No data
1175625145_1175625150 -7 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625150 20:60483675-60483697 CTGGGTGCTGGTCAAATGATGGG No data
1175625145_1175625151 -6 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625151 20:60483676-60483698 TGGGTGCTGGTCAAATGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625145 Original CRISPR CACCCAGCAGACCCCACTTG GGG (reversed) Intergenic
No off target data available for this crispr