ID: 1175625147

View in Genome Browser
Species Human (GRCh38)
Location 20:60483661-60483683
Sequence AGCACCCAGCAGACCCCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625147_1175625153 -3 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625153 20:60483681-60483703 GCTGGTCAAATGATGGGGAAGGG No data
1175625147_1175625156 13 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625156 20:60483697-60483719 GGAAGGGGAGCTCTAGGTACAGG No data
1175625147_1175625152 -4 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625152 20:60483680-60483702 TGCTGGTCAAATGATGGGGAAGG No data
1175625147_1175625151 -8 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625151 20:60483676-60483698 TGGGTGCTGGTCAAATGATGGGG No data
1175625147_1175625149 -10 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625149 20:60483674-60483696 GCTGGGTGCTGGTCAAATGATGG No data
1175625147_1175625150 -9 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625150 20:60483675-60483697 CTGGGTGCTGGTCAAATGATGGG No data
1175625147_1175625155 7 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625155 20:60483691-60483713 TGATGGGGAAGGGGAGCTCTAGG No data
1175625147_1175625154 -2 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625154 20:60483682-60483704 CTGGTCAAATGATGGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625147 Original CRISPR AGCACCCAGCAGACCCCACT TGG (reversed) Intergenic