ID: 1175625148

View in Genome Browser
Species Human (GRCh38)
Location 20:60483663-60483685
Sequence AAGTGGGGTCTGCTGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625138_1175625148 10 Left 1175625138 20:60483630-60483652 CCACCATAGCTTGGAGGACTGAA No data
Right 1175625148 20:60483663-60483685 AAGTGGGGTCTGCTGGGTGCTGG No data
1175625139_1175625148 7 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625148 20:60483663-60483685 AAGTGGGGTCTGCTGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625148 Original CRISPR AAGTGGGGTCTGCTGGGTGC TGG Intergenic
No off target data available for this crispr