ID: 1175625153

View in Genome Browser
Species Human (GRCh38)
Location 20:60483681-60483703
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625139_1175625153 25 Left 1175625139 20:60483633-60483655 CCATAGCTTGGAGGACTGAATTA No data
Right 1175625153 20:60483681-60483703 GCTGGTCAAATGATGGGGAAGGG No data
1175625146_1175625153 -2 Left 1175625146 20:60483660-60483682 CCCAAGTGGGGTCTGCTGGGTGC No data
Right 1175625153 20:60483681-60483703 GCTGGTCAAATGATGGGGAAGGG No data
1175625145_1175625153 -1 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625153 20:60483681-60483703 GCTGGTCAAATGATGGGGAAGGG No data
1175625147_1175625153 -3 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625153 20:60483681-60483703 GCTGGTCAAATGATGGGGAAGGG No data
1175625138_1175625153 28 Left 1175625138 20:60483630-60483652 CCACCATAGCTTGGAGGACTGAA No data
Right 1175625153 20:60483681-60483703 GCTGGTCAAATGATGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625153 Original CRISPR GCTGGTCAAATGATGGGGAA GGG Intergenic
No off target data available for this crispr