ID: 1175625155

View in Genome Browser
Species Human (GRCh38)
Location 20:60483691-60483713
Sequence TGATGGGGAAGGGGAGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625147_1175625155 7 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625155 20:60483691-60483713 TGATGGGGAAGGGGAGCTCTAGG No data
1175625146_1175625155 8 Left 1175625146 20:60483660-60483682 CCCAAGTGGGGTCTGCTGGGTGC No data
Right 1175625155 20:60483691-60483713 TGATGGGGAAGGGGAGCTCTAGG No data
1175625145_1175625155 9 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625155 20:60483691-60483713 TGATGGGGAAGGGGAGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625155 Original CRISPR TGATGGGGAAGGGGAGCTCT AGG Intergenic