ID: 1175625156

View in Genome Browser
Species Human (GRCh38)
Location 20:60483697-60483719
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625146_1175625156 14 Left 1175625146 20:60483660-60483682 CCCAAGTGGGGTCTGCTGGGTGC No data
Right 1175625156 20:60483697-60483719 GGAAGGGGAGCTCTAGGTACAGG No data
1175625145_1175625156 15 Left 1175625145 20:60483659-60483681 CCCCAAGTGGGGTCTGCTGGGTG No data
Right 1175625156 20:60483697-60483719 GGAAGGGGAGCTCTAGGTACAGG No data
1175625147_1175625156 13 Left 1175625147 20:60483661-60483683 CCAAGTGGGGTCTGCTGGGTGCT No data
Right 1175625156 20:60483697-60483719 GGAAGGGGAGCTCTAGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625156 Original CRISPR GGAAGGGGAGCTCTAGGTAC AGG Intergenic