ID: 1175625622

View in Genome Browser
Species Human (GRCh38)
Location 20:60486349-60486371
Sequence AACGGTTGGACTCCCGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175625619_1175625622 -1 Left 1175625619 20:60486327-60486349 CCTTGGTGTCTATTTTTATTGAA No data
Right 1175625622 20:60486349-60486371 AACGGTTGGACTCCCGCTTTTGG No data
1175625618_1175625622 4 Left 1175625618 20:60486322-60486344 CCTGGCCTTGGTGTCTATTTTTA No data
Right 1175625622 20:60486349-60486371 AACGGTTGGACTCCCGCTTTTGG No data
1175625617_1175625622 7 Left 1175625617 20:60486319-60486341 CCTCCTGGCCTTGGTGTCTATTT No data
Right 1175625622 20:60486349-60486371 AACGGTTGGACTCCCGCTTTTGG No data
1175625615_1175625622 18 Left 1175625615 20:60486308-60486330 CCATATTTAAGCCTCCTGGCCTT No data
Right 1175625622 20:60486349-60486371 AACGGTTGGACTCCCGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175625622 Original CRISPR AACGGTTGGACTCCCGCTTT TGG Intergenic
No off target data available for this crispr