ID: 1175638141

View in Genome Browser
Species Human (GRCh38)
Location 20:60602664-60602686
Sequence GCATTTACCCTGGAGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175638134_1175638141 6 Left 1175638134 20:60602635-60602657 CCATTGTACTCTTCAGTGCCGTG No data
Right 1175638141 20:60602664-60602686 GCATTTACCCTGGAGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175638141 Original CRISPR GCATTTACCCTGGAGTGCTG GGG Intergenic
No off target data available for this crispr