ID: 1175639145

View in Genome Browser
Species Human (GRCh38)
Location 20:60612486-60612508
Sequence CTTTCTAGGGATTGGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175639145_1175639152 24 Left 1175639145 20:60612486-60612508 CCAGCCATCCAATCCCTAGAAAG No data
Right 1175639152 20:60612533-60612555 TCTCAATAGCAATTATTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175639145 Original CRISPR CTTTCTAGGGATTGGATGGC TGG (reversed) Intergenic
No off target data available for this crispr