ID: 1175643278 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:60649392-60649414 |
Sequence | GTCCAAGTGATGTGGGAGGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1175643278_1175643285 | 10 | Left | 1175643278 | 20:60649392-60649414 | CCTGCCTCCCACATCACTTGGAC | No data | ||
Right | 1175643285 | 20:60649425-60649447 | GCCTCCCTCTTCCACTCTCGAGG | No data | ||||
1175643278_1175643290 | 26 | Left | 1175643278 | 20:60649392-60649414 | CCTGCCTCCCACATCACTTGGAC | No data | ||
Right | 1175643290 | 20:60649441-60649463 | CTCGAGGACCTGCGATGACACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1175643278 | Original CRISPR | GTCCAAGTGATGTGGGAGGC AGG (reversed) | Intergenic | ||