ID: 1175643278

View in Genome Browser
Species Human (GRCh38)
Location 20:60649392-60649414
Sequence GTCCAAGTGATGTGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175643278_1175643285 10 Left 1175643278 20:60649392-60649414 CCTGCCTCCCACATCACTTGGAC No data
Right 1175643285 20:60649425-60649447 GCCTCCCTCTTCCACTCTCGAGG No data
1175643278_1175643290 26 Left 1175643278 20:60649392-60649414 CCTGCCTCCCACATCACTTGGAC No data
Right 1175643290 20:60649441-60649463 CTCGAGGACCTGCGATGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175643278 Original CRISPR GTCCAAGTGATGTGGGAGGC AGG (reversed) Intergenic