ID: 1175645895

View in Genome Browser
Species Human (GRCh38)
Location 20:60671391-60671413
Sequence TGAGTCACAAACTCACAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175645895_1175645897 -4 Left 1175645895 20:60671391-60671413 CCCGGCTGTGAGTTTGTGACTCA No data
Right 1175645897 20:60671410-60671432 CTCAAGCTTTCCTGAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175645895 Original CRISPR TGAGTCACAAACTCACAGCC GGG (reversed) Intergenic
No off target data available for this crispr