ID: 1175645897

View in Genome Browser
Species Human (GRCh38)
Location 20:60671410-60671432
Sequence CTCAAGCTTTCCTGAGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175645891_1175645897 18 Left 1175645891 20:60671369-60671391 CCCACCTAAGGGTTCTCACTCAC No data
Right 1175645897 20:60671410-60671432 CTCAAGCTTTCCTGAGCCTGTGG No data
1175645895_1175645897 -4 Left 1175645895 20:60671391-60671413 CCCGGCTGTGAGTTTGTGACTCA No data
Right 1175645897 20:60671410-60671432 CTCAAGCTTTCCTGAGCCTGTGG No data
1175645893_1175645897 14 Left 1175645893 20:60671373-60671395 CCTAAGGGTTCTCACTCACCCGG No data
Right 1175645897 20:60671410-60671432 CTCAAGCTTTCCTGAGCCTGTGG No data
1175645896_1175645897 -5 Left 1175645896 20:60671392-60671414 CCGGCTGTGAGTTTGTGACTCAA No data
Right 1175645897 20:60671410-60671432 CTCAAGCTTTCCTGAGCCTGTGG No data
1175645892_1175645897 17 Left 1175645892 20:60671370-60671392 CCACCTAAGGGTTCTCACTCACC No data
Right 1175645897 20:60671410-60671432 CTCAAGCTTTCCTGAGCCTGTGG No data
1175645890_1175645897 19 Left 1175645890 20:60671368-60671390 CCCCACCTAAGGGTTCTCACTCA No data
Right 1175645897 20:60671410-60671432 CTCAAGCTTTCCTGAGCCTGTGG No data
1175645889_1175645897 27 Left 1175645889 20:60671360-60671382 CCATTTTGCCCCACCTAAGGGTT No data
Right 1175645897 20:60671410-60671432 CTCAAGCTTTCCTGAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175645897 Original CRISPR CTCAAGCTTTCCTGAGCCTG TGG Intergenic
No off target data available for this crispr