ID: 1175645920

View in Genome Browser
Species Human (GRCh38)
Location 20:60671590-60671612
Sequence CCCGACCCCGTGGTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175645920_1175645928 10 Left 1175645920 20:60671590-60671612 CCCCATCACACCACGGGGTCGGG No data
Right 1175645928 20:60671623-60671645 CCCTTACAAAAAAGAAAGCTCGG No data
1175645920_1175645930 11 Left 1175645920 20:60671590-60671612 CCCCATCACACCACGGGGTCGGG No data
Right 1175645930 20:60671624-60671646 CCTTACAAAAAAGAAAGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175645920 Original CRISPR CCCGACCCCGTGGTGTGATG GGG (reversed) Intergenic
No off target data available for this crispr