ID: 1175647378

View in Genome Browser
Species Human (GRCh38)
Location 20:60686070-60686092
Sequence GACAATGATGACAGTACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175647378_1175647382 -6 Left 1175647378 20:60686070-60686092 CCTGCTGTACTGTCATCATTGTC No data
Right 1175647382 20:60686087-60686109 ATTGTCAGGAGCATCACCAGGGG No data
1175647378_1175647381 -7 Left 1175647378 20:60686070-60686092 CCTGCTGTACTGTCATCATTGTC No data
Right 1175647381 20:60686086-60686108 CATTGTCAGGAGCATCACCAGGG No data
1175647378_1175647380 -8 Left 1175647378 20:60686070-60686092 CCTGCTGTACTGTCATCATTGTC No data
Right 1175647380 20:60686085-60686107 TCATTGTCAGGAGCATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175647378 Original CRISPR GACAATGATGACAGTACAGC AGG (reversed) Intergenic
No off target data available for this crispr