ID: 1175654763

View in Genome Browser
Species Human (GRCh38)
Location 20:60760533-60760555
Sequence CTCTGTAGTGGGGAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175654763_1175654774 14 Left 1175654763 20:60760533-60760555 CCACCCACCTCCCCACTACAGAG No data
Right 1175654774 20:60760570-60760592 ATGCCAAAAGCACTGAAGCCGGG No data
1175654763_1175654773 13 Left 1175654763 20:60760533-60760555 CCACCCACCTCCCCACTACAGAG No data
Right 1175654773 20:60760569-60760591 AATGCCAAAAGCACTGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175654763 Original CRISPR CTCTGTAGTGGGGAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr