ID: 1175656157

View in Genome Browser
Species Human (GRCh38)
Location 20:60772836-60772858
Sequence CCTCATGCCCAGATAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175656157_1175656163 14 Left 1175656157 20:60772836-60772858 CCCAGCTCTATCTGGGCATGAGG No data
Right 1175656163 20:60772873-60772895 AAACCACAGGCTCCACCTGAAGG No data
1175656157_1175656161 1 Left 1175656157 20:60772836-60772858 CCCAGCTCTATCTGGGCATGAGG No data
Right 1175656161 20:60772860-60772882 AGCAGAGAACCAAAAACCACAGG No data
1175656157_1175656165 23 Left 1175656157 20:60772836-60772858 CCCAGCTCTATCTGGGCATGAGG No data
Right 1175656165 20:60772882-60772904 GCTCCACCTGAAGGTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175656157 Original CRISPR CCTCATGCCCAGATAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr