ID: 1175656161

View in Genome Browser
Species Human (GRCh38)
Location 20:60772860-60772882
Sequence AGCAGAGAACCAAAAACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175656152_1175656161 12 Left 1175656152 20:60772825-60772847 CCCACCTTGTACCCAGCTCTATC No data
Right 1175656161 20:60772860-60772882 AGCAGAGAACCAAAAACCACAGG No data
1175656155_1175656161 8 Left 1175656155 20:60772829-60772851 CCTTGTACCCAGCTCTATCTGGG No data
Right 1175656161 20:60772860-60772882 AGCAGAGAACCAAAAACCACAGG No data
1175656153_1175656161 11 Left 1175656153 20:60772826-60772848 CCACCTTGTACCCAGCTCTATCT No data
Right 1175656161 20:60772860-60772882 AGCAGAGAACCAAAAACCACAGG No data
1175656150_1175656161 23 Left 1175656150 20:60772814-60772836 CCCAATGAGGTCCCACCTTGTAC No data
Right 1175656161 20:60772860-60772882 AGCAGAGAACCAAAAACCACAGG No data
1175656157_1175656161 1 Left 1175656157 20:60772836-60772858 CCCAGCTCTATCTGGGCATGAGG No data
Right 1175656161 20:60772860-60772882 AGCAGAGAACCAAAAACCACAGG No data
1175656151_1175656161 22 Left 1175656151 20:60772815-60772837 CCAATGAGGTCCCACCTTGTACC No data
Right 1175656161 20:60772860-60772882 AGCAGAGAACCAAAAACCACAGG No data
1175656159_1175656161 0 Left 1175656159 20:60772837-60772859 CCAGCTCTATCTGGGCATGAGGG No data
Right 1175656161 20:60772860-60772882 AGCAGAGAACCAAAAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175656161 Original CRISPR AGCAGAGAACCAAAAACCAC AGG Intergenic
No off target data available for this crispr