ID: 1175656165

View in Genome Browser
Species Human (GRCh38)
Location 20:60772882-60772904
Sequence GCTCCACCTGAAGGTGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175656155_1175656165 30 Left 1175656155 20:60772829-60772851 CCTTGTACCCAGCTCTATCTGGG No data
Right 1175656165 20:60772882-60772904 GCTCCACCTGAAGGTGCTCATGG No data
1175656157_1175656165 23 Left 1175656157 20:60772836-60772858 CCCAGCTCTATCTGGGCATGAGG No data
Right 1175656165 20:60772882-60772904 GCTCCACCTGAAGGTGCTCATGG No data
1175656162_1175656165 -10 Left 1175656162 20:60772869-60772891 CCAAAAACCACAGGCTCCACCTG No data
Right 1175656165 20:60772882-60772904 GCTCCACCTGAAGGTGCTCATGG No data
1175656159_1175656165 22 Left 1175656159 20:60772837-60772859 CCAGCTCTATCTGGGCATGAGGG No data
Right 1175656165 20:60772882-60772904 GCTCCACCTGAAGGTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175656165 Original CRISPR GCTCCACCTGAAGGTGCTCA TGG Intergenic
No off target data available for this crispr