ID: 1175659047

View in Genome Browser
Species Human (GRCh38)
Location 20:60796539-60796561
Sequence TAGGTTGCTTGCCCCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175659047_1175659054 8 Left 1175659047 20:60796539-60796561 CCTCCTCAGGGGCAAGCAACCTA No data
Right 1175659054 20:60796570-60796592 CACAGGGCCCAAGCTCAGAAGGG No data
1175659047_1175659057 19 Left 1175659047 20:60796539-60796561 CCTCCTCAGGGGCAAGCAACCTA No data
Right 1175659057 20:60796581-60796603 AGCTCAGAAGGGCCCACACTTGG No data
1175659047_1175659053 7 Left 1175659047 20:60796539-60796561 CCTCCTCAGGGGCAAGCAACCTA No data
Right 1175659053 20:60796569-60796591 ACACAGGGCCCAAGCTCAGAAGG No data
1175659047_1175659051 -8 Left 1175659047 20:60796539-60796561 CCTCCTCAGGGGCAAGCAACCTA No data
Right 1175659051 20:60796554-60796576 GCAACCTAGGCATTCACACAGGG No data
1175659047_1175659050 -9 Left 1175659047 20:60796539-60796561 CCTCCTCAGGGGCAAGCAACCTA No data
Right 1175659050 20:60796553-60796575 AGCAACCTAGGCATTCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175659047 Original CRISPR TAGGTTGCTTGCCCCTGAGG AGG (reversed) Intergenic
No off target data available for this crispr