ID: 1175660041

View in Genome Browser
Species Human (GRCh38)
Location 20:60804522-60804544
Sequence TTGTGGGTCAGGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175660034_1175660041 -6 Left 1175660034 20:60804505-60804527 CCTCTGAGGGTTTATCCTTGTGG No data
Right 1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG No data
1175660033_1175660041 2 Left 1175660033 20:60804497-60804519 CCTTCTGGCCTCTGAGGGTTTAT No data
Right 1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG No data
1175660032_1175660041 3 Left 1175660032 20:60804496-60804518 CCCTTCTGGCCTCTGAGGGTTTA No data
Right 1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG No data
1175660029_1175660041 8 Left 1175660029 20:60804491-60804513 CCGATCCCTTCTGGCCTCTGAGG No data
Right 1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175660041 Original CRISPR TTGTGGGTCAGGAAGGAAGA GGG Intergenic
No off target data available for this crispr