ID: 1175660667

View in Genome Browser
Species Human (GRCh38)
Location 20:60809294-60809316
Sequence CCTTTATTTTATCTCAGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175660667_1175660673 -3 Left 1175660667 20:60809294-60809316 CCTCTACTGAGATAAAATAAAGG No data
Right 1175660673 20:60809314-60809336 AGGGGCCCCGGCATTGCCGAGGG No data
1175660667_1175660672 -4 Left 1175660667 20:60809294-60809316 CCTCTACTGAGATAAAATAAAGG No data
Right 1175660672 20:60809313-60809335 AAGGGGCCCCGGCATTGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175660667 Original CRISPR CCTTTATTTTATCTCAGTAG AGG (reversed) Intergenic
No off target data available for this crispr