ID: 1175660672

View in Genome Browser
Species Human (GRCh38)
Location 20:60809313-60809335
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175660667_1175660672 -4 Left 1175660667 20:60809294-60809316 CCTCTACTGAGATAAAATAAAGG No data
Right 1175660672 20:60809313-60809335 AAGGGGCCCCGGCATTGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175660672 Original CRISPR AAGGGGCCCCGGCATTGCCG AGG Intergenic
No off target data available for this crispr