ID: 1175660793

View in Genome Browser
Species Human (GRCh38)
Location 20:60810319-60810341
Sequence AATGAAACAGTGAAAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175660793_1175660799 2 Left 1175660793 20:60810319-60810341 CCCTCAACTTTCACTGTTTCATT No data
Right 1175660799 20:60810344-60810366 GCCCCTGGGCCCCACTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175660793 Original CRISPR AATGAAACAGTGAAAGTTGA GGG (reversed) Intergenic