ID: 1175660799

View in Genome Browser
Species Human (GRCh38)
Location 20:60810344-60810366
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175660792_1175660799 5 Left 1175660792 20:60810316-60810338 CCTCCCTCAACTTTCACTGTTTC No data
Right 1175660799 20:60810344-60810366 GCCCCTGGGCCCCACTGTACAGG No data
1175660794_1175660799 1 Left 1175660794 20:60810320-60810342 CCTCAACTTTCACTGTTTCATTG No data
Right 1175660799 20:60810344-60810366 GCCCCTGGGCCCCACTGTACAGG No data
1175660793_1175660799 2 Left 1175660793 20:60810319-60810341 CCCTCAACTTTCACTGTTTCATT No data
Right 1175660799 20:60810344-60810366 GCCCCTGGGCCCCACTGTACAGG No data
1175660789_1175660799 24 Left 1175660789 20:60810297-60810319 CCCAGCTGAGAGGAAATGCCCTC No data
Right 1175660799 20:60810344-60810366 GCCCCTGGGCCCCACTGTACAGG No data
1175660791_1175660799 6 Left 1175660791 20:60810315-60810337 CCCTCCCTCAACTTTCACTGTTT No data
Right 1175660799 20:60810344-60810366 GCCCCTGGGCCCCACTGTACAGG No data
1175660790_1175660799 23 Left 1175660790 20:60810298-60810320 CCAGCTGAGAGGAAATGCCCTCC No data
Right 1175660799 20:60810344-60810366 GCCCCTGGGCCCCACTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175660799 Original CRISPR GCCCCTGGGCCCCACTGTAC AGG Intergenic