ID: 1175661890

View in Genome Browser
Species Human (GRCh38)
Location 20:60820569-60820591
Sequence GACAGTGAATAAGTGTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175661883_1175661890 30 Left 1175661883 20:60820516-60820538 CCGGGGGGAGATAATCGAATCAT No data
Right 1175661890 20:60820569-60820591 GACAGTGAATAAGTGTCATGAGG No data
1175661888_1175661890 -7 Left 1175661888 20:60820553-60820575 CCCATGCTGTTCTCATGACAGTG 0: 227
1: 2550
2: 5717
3: 8031
4: 7784
Right 1175661890 20:60820569-60820591 GACAGTGAATAAGTGTCATGAGG No data
1175661889_1175661890 -8 Left 1175661889 20:60820554-60820576 CCATGCTGTTCTCATGACAGTGA 0: 368
1: 3399
2: 6153
3: 7559
4: 6452
Right 1175661890 20:60820569-60820591 GACAGTGAATAAGTGTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175661890 Original CRISPR GACAGTGAATAAGTGTCATG AGG Intergenic
No off target data available for this crispr