ID: 1175663287

View in Genome Browser
Species Human (GRCh38)
Location 20:60836210-60836232
Sequence TTAGCTACACAGACTCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175663282_1175663287 23 Left 1175663282 20:60836164-60836186 CCTCTCAACATGGGGTACAACAA No data
Right 1175663287 20:60836210-60836232 TTAGCTACACAGACTCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175663287 Original CRISPR TTAGCTACACAGACTCCTCA GGG Intergenic
No off target data available for this crispr