ID: 1175664087

View in Genome Browser
Species Human (GRCh38)
Location 20:60843607-60843629
Sequence GTCCCCTGCCAGTTTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175664087_1175664091 0 Left 1175664087 20:60843607-60843629 CCAAGGGAAAACTGGCAGGGGAC No data
Right 1175664091 20:60843630-60843652 AGGCAGGAGAGGCCCATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175664087 Original CRISPR GTCCCCTGCCAGTTTTCCCT TGG (reversed) Intergenic
No off target data available for this crispr